1、ReviewNuclear Factor One X in Development andDiseaseMichael Piper,1,*Richard Gronostajski,2and Graziella Messina3,*The past decade has seen incredible advances in the field of stem cell biology thathave greatly improved our understanding of development and provided importantinsights into pathologica
2、l processes.Transcription factors(TFs)play a central rolein mediating stem cell proliferation,quiescence,and differentiation.One TF thatcontributes to these processes is Nuclear Factor One X(NFIX).Recently,NFIXactivity has been shown to be essential in multiple organ systems and to haveimportant tra
3、nslational impacts for human health.Here,we describe recent stud-ies showing the contribution of NFIX to muscle development and musculardystrophies,hematopoiesis,cancer,and neural stem cell biology,highlightingthe importance of this knowledge in the development of therapeutic targets.NFIX and the NF
4、I FamilyNFIX is a member of the NFI(nuclear factor I)TF family that also includes NFIA,NFIB,and NFIC.The NFI family was discovered as a protein fraction from human cells that was essential for thein vitro replication of adenovirus type 4(Ad4)DNA 1 and was then shown to possess site-specific DNA-bind
5、ing activity specific for both Ad4 replication origins 2 and cellular sites 3.Two subsequent studies independently discovered the NFI proteins,naming them as TGGCA-binding protein 4 and CAAT-box TF 5.Genes encoding all four NFI family members were firstcloned from chicken 6,7 and then from mouse 8;i
6、ndeed,four homologous genes exist in allmammals 9.All four genes encode proteins with a highly conserved N-terminal DNA-bindingand dimerization domain.The C-terminal transactivation/repression(see Glossary)domainsof each NFI family member exhibit markedly lower conservation between family members 5.
7、mRNA from NFI genes can be alternatively spliced,yielding up to a dozen isoforms 10.Onlysingle NFI genes are present in non-vertebrates,including Caenorhabditis elegans and Dro-sophila 9,11.NFI proteins bind as homo-or hetero-dimers 12 to the dyad consensussequence TTGGCN5GCCAA and bind specifically
8、,but less tightly,to 1/2 sites(i.e.,TTGGCor GCCAA)13,14.Differential expression of Nfix during mouse embryogenesis was an earlyindication that this gene might be important for development 8.The subsequent generation ofgermline and conditional knockout alleles of Nfix provided the essential tools to
9、determine theroles of NFIX in various organ systems 15,16.One of the recurrent themes that has emergedwith regard to the role of the NFI family members during development is their role in regulatingstem cell biology(Table 1,Key Table).Although previous reviews have discussed the entire NFIgene famil
10、y 1719 or NFIB alone 20,because NFIX has recently been shown to play essentialroles in several organ systems,we focus here on the role of NFIX in development,adultphysiology,genetic disease,and cancer(Figure 1;Table 1).NFIX Expression within the Nervous SystemThe NFI family members are broadly expre
11、ssed within the developing and adult nervoussystem,and because of these expression patterns,they have been implicated in multiplefacets of neural development and function.Nfix,for instance,is highly expressed in theHighlightsNFIX activity is tissue/cell specific andoften depends on interaction partn
12、ersincluding Fox and Sox proteins.NFIX is essential for normal muscledevelopment and can influence mus-cle diseases.NFIX plays a significant role inhematopoiesis.Mutations in NFIX affect human braindevelopment and cancer.NFIX might be a therapeutic target fordifferent diseases,including muscleand br
13、ain disorders.1School of Biomedical Sciences,TheUniversity of Queensland,Brisbane,Queensland 4072,Australia2Department of Biochemistry,Genetics,Genomics&BioinformaticsGraduate Program,New York StateCenter of Excellence in Bioinformaticsand Life Sciences,University atBuffalo,Buffalo,NY 14203,USA3Depa
14、rtment of Biosciences,University of Milan,via Celoria 26,20133,Milan,Italy*Correspondence:m.piperuq.edu.au(M.Piper)andgraziella.messinaunimi.it(G.Messina).TICB 1460 No.of Pages 11Trends in Cell Biology,Month Year,Vol.xx,No.yy https:/doi.org/10.1016/j.tcb.2018.09.003 1 2018 Elsevier Ltd.All rights re
15、served.TICB 1460 No.of Pages 11embryonic mouse telencephalon throughout embryogenesis,as well as by cells within thecerebellum,pontine nuclei,and spinal cord 8.This early study also revealed NFIX expressionwithin mature neuronal populations within the postnatal and adult cerebellum,as well as bycell
16、s within the grey matter of the cerebral cortex 8.More recent studies using NFIX-specificGlossaryChromatin immunoprecipitation(ChIP):an experimental techniqueused to investigate the bindingbetween a defined protein and theDNA in the cell.Corticogenesis:a process thatdrives the development of thecere
17、bral cortex.HSPCs:hematopoietic stem andprogenitor cells.Malan syndrome:a disordercaused by mutations to exons 2/3 ofNFIX,associated with macrocephaly,intellectual disability,and overgrowthof the body.MarshallSmith syndrome:adisorder caused by frameshiftmutations to exons 610 of NFIX,associated with
18、 intellectual disability,advanced bone age,intellectualdisability,and a failure to thrive.Megalencephaly:a disordercharacterized by abnormally largebrain size.Myogenesis:a process responsiblefor the formation of skeletal muscletissue,in particular during embryonicdevelopment.Muscular dystrophy:class
19、 ofsevere muscular disordersassociated with muscle wasting andexhaustion of muscle regenerationpotential,due to the inability ofmuscle stem cells to efficientlyregenerate the tissue.Telencephalon:the mammaliancerebrum,which contains thecerebral cortex as well as subcorticalstructures such as the str
20、iatum.Transactivation:increasedexpression of a gene requiring thepresence of another protein called atransactivator.Table 1.Key TableOrgan system or disease Evidence for role of NFIX RefsCNS(brain size)Nfix/mice have significantly larger brains 16CNS(hippocampus)Delayed hippocampal progenitor cell d
21、ifferentiation in Nfix/mice 21Reduced symmetric neural stem cell divisions in Nfix/mice 22Bias towards oligodendrogenesis in Nfix/hippocampal NSCs 25Nfix/mice have defects in learning and memory 33CNS(cortex and ventricles)Aberrant neuroblast progenitor proliferation in SVZ and neuroblast migration
22、inRMS of Nfix/mice24Delayed radial glial differentiation in Nfix/mice 31Bias towards oligodendrogenesis in Nfix/NSCs 40Nfix implicated in regulation of quiescence of NSCs 68Nfix required for normal ependymal cell structure and function 26CNS(cerebellum)Nfix is expressed in multiple cell populations
23、in cerebellum 27Delay in development of cerebellar granule neurons,Purkinje cells,andBergmann glia in Nfix/cerebella30PNS(spinal cord)Delayed astrocyte differentiation in Nfix/spinal cord 28Hematopoiesis Reduced colony-forming ability in Nfix-deficient HSPCs 49Nfix promotes Mpl expression and HSPC s
24、urvival 50Nfix can promote conversion of B cells to myeloid cells 51Loss of Nfix promotes myeloid and lymphoid differentiation 52Musculature NFIX regulates embryonic-to-fetal muscle transition 56NFIX interacts with PKCu and Mef2A,activating MCK expression 56NFIX represses MyHC-I expression by inhibi
25、ting NFATc4 55Nfix modulates myostatin expression 60Nfix mediates Sox6 inhibition of MyHC-I expression 57Silencing NFIX rescues muscular dystrophy 76Cancer NFIX expression reduced in poor prognosis medulloblastoma 42NFIX identified as possible tumor suppressor in glioma 43NFIX regulates prostate-spe
26、cific gene expression 44NFIX target of miR1290 in squamous cell carcinoma 46NFIX target for miR647 and miR1914 in colorectal cancer 46Malan syndrome Presumptive inactivating mutations in NFIX associated with a novel form ofSotos syndrome34MarshallSmith syndrome Presumptive dominant-negative mutation
27、s in NFIX associated with MarshallSmith syndrome35Bipolar disorder NFIX identified in GWAS studies associated with bipolar disorder 48Abbreviations:CNS,central nervous system;GWAS,genome-wide association study;PNS,peripheral nervous system;RMS,rostral migratory stream;SVZ,subventricular zone.2 Trend
28、s in Cell Biology,Month Year,Vol.xx,No.yyTICB 1460 No.of Pages 11antibodies(Tables 24)focusing on the cerebral cortex have supported these findings,revealing that NFIX is expressed within the germinal zones of the embryonic mouse neocortexand hippocampus,as well as by cells within the emerging corti
29、cal plate 16,21.Indeed,analyses of cell typespecific markers,in conjunction with anti-NFIX antibodies,have revealedthat both radial glia and intermediate progenitor cells within the embryonic mouse cerebralcortex express NFIX 22,suggesting a key role for NFIX in regulating the biology of these neura
30、lprogenitor cells during corticogenesis.NFIX is also expressed in the mature rodent cerebralcortex,with prominent expression of this TF by cells within layers II/III of the cortical plate 23.Interestingly,approximately half of all neurons within the mature mouse neocortex expressNFIX,whereas very fe
31、w GFAP-expressing or s100B-expressing astrocytes,or OLIG2-express-ing oligodendrocytes express this factor,suggesting that NFIX mediates ongoing transcrip-tional activity within some mature neurons,but in few glia,of the mature neocortex 23.Theadult rodent brain also contains niches in which neuroge
32、nesis persists throughout life,namely,the ventricular-subventricular zone lining the lateral ventricles and the subgranular zone of thehippocampal dentate gyrus 19.NFIX expression is prominent within these zones 24;forinstance,NFIX is expressed in quiescent and dividing progenitor cells,transit ampl
33、ifying cells,NFIX func?ons in mul?ple systemsBrain and PNSMusculatureCancerHematopoiesisOthers?Figure 1.An Image of the VitruvianMan by Leonardo da Vinci,Illustrat-ing the Proportions of the HumanBody,Surrounded by Text Describ-ing Organ Systems and DiseaseStates Known to Be Affected byNFIX.These in
34、clude multiple regions ofthe developing brain and spinal cordlabeled as Brain and peripheral nervoussystem(PNS),the blood-forming cells(Hematopoiesis),the development ofembryonic and fetal muscle cells(Muscu-lature),several types of cancer(Cancer),and other as yet undiscovered organ sys-tems and syn
35、dromes(Others?).Table 2.Current Reagents to Detect NFIX-Specific AntibodiesReagentaReactivity Host Dilution Company RefsAnti-NFIX Mouse Rabbit(polyclonal)WB1:10 000 in signal boost(Millipore)Active Motif 21NBP2-15038 Mouse Rabbit(polyclonal)Immunohistochemistry-Muscle sections(fixed in 4%PFA),1:200-
36、Cell cultures(fixed in 4%PFA 4%),1:200Novus Biologicals 57SAB1401263 Human,mouse Mouse(monoclonal)WB1:1000 in 5%milkSigma-Aldrich 26Abbreviations:PFA,paraformaldehyde;WB,western blot.aValidated antibodies that specifically detect NFIX.Trends in Cell Biology,Month Year,Vol.xx,No.yy 3TICB 1460 No.of P
37、ages 11and neuroblasts within the adult dentate gyrus 25.Finally,ependymal cells of the lateralventricles of the developing and adult telencephalon express this factor 23,26.NFIX expres-sion is also evident within granule neuron progenitor cells within the postnatal cerebellum andby granule neurons
38、within the internal granule cell layer of the mature cerebellum 27,as well asTable 3.Current Vectors for NFIXPlasmidaRefspCH-Nfix2pCH-HA55pLenti-NFIX2-HA 55pLentiHA-NfiEngrpLentiHA-Engr55pCAGG-NFIX2 75pCMV5aFLAG-Nfix1(human)38pCMV5aFLAG-Nfix3(human)38pCCL-MNDU3-Gateway-PGK-GFP FLAG-Nfix 49aAvailable
39、 plasmids and lentiviral vectors to study NFIX.Table 4.Current Reagents to Investigate NFIX FunctionaTransgenic animals RefsSpecies Species nameMouse Tg:MLC1f-Nfix2 55Mouse Nfix-null 15Mouse Nfixflox/flox16Knockdown reagentsMorpholino SequenceATG-targeting morpholino(nfixa-MO)(Gene Tools)50-CCGGTCTC
40、AAAGGCGGGAAATGATT-3058nfixa-splice-MO(Gene Tools)50-AAGAAAGAGAGTGTAACCCACTGAC-3058siRNA CompanypLKO.1siNfix Dharmacon 55si-panNFI-X Dharmacon 38si-NFI-X3 Dharmacon 38shRNA Sequence(senseloopantisense)Nfix#1 CCCGGACAATCAGATAGTTCAATAGTGAAGCCACAGATGTATTGAACTATCTGATTGTCCGGA49Nfix#2 CCACATTGGAGTCACAATCAA
41、ATAGTGAAGCCACAGATGTATTTGATTGTGACTCCAATGTGA49Nfix#3 ACCCCAGCTACTACAACATAAATAGTGAAGCCACAGATGTATTTATGTTGTAGTAGCTGGGGC49Abbreviations:ATG,translational starting site of a protein;MO,morpholino;shRNA,short hairpin RNA;siRNA,shortinterfering RNA.aAvailable mouse strains and knockdown reagents that are cur
42、rently used to assess NFIX function.4 Trends in Cell Biology,Month Year,Vol.xx,No.yyTICB 1460 No.of Pages 11by progenitor cells within the developing mouse spinal cord from embryonic day(E)13.5 28.Analysis of NFIX expression in the developing and adult human brain by using online resourcesincluding
43、the Allen Brain Atlas(https:/www.brain-map.org/)and the Human Protein Atlas(https:/www.proteinatlas.org/)also reveals broad expression of NFIX within multiple regions ofthe brain,including the cerebral cortex and cerebellum.NFIX Regulates Multiple Aspects of Neural DevelopmentGiven its widespread ex
44、pression,it is perhaps not surprising that NFIX regulates a variety ofprocesses during development,as well as having been implicated in neurological disorders andcancers of the brain 29.Mice lacking Nfix have proven pivotal in defining the role of NFIX in neuraldevelopment(Table 1)15,16,30.For examp
45、le,we have previously used these mice to show thatthe differentiation of neural stem cells(NSCs)of the developing cerebral cortex(known as radialglia)is delayed in the absence of Nfix 21,31.This culminates in reduced glial and neuronaldifferentiation at late embryogenesis in these mice 21.At a mecha
46、nistic level,we have recentlyrevealed that NFIX promotes the generation of intermediate progenitor cells(IPCs)from radial glialstem cells,in part via the transcriptional activation of inscuteable(Insc).INSC itself acts to drive IPCformation viathe modulation ofapical-basalspindle orientation 32.One
47、corollaryofthisstudywasthat,with a longer period of radial glial self-renewal,one would hypothesize that Nfix-deficient micewould ultimately generate morepost-mitotic daughtercellsand hence exhibitenlarged cortices,ormegalencephaly.Wehavepreviouslydemonstrated thatpostnatalNfix/micedoindeed exhibitm
48、egalencephaly 16.However,given that these mice die at weaning,for reasons that are not yetdefined,understanding the true extent of brain enlargement in Nfix-deficient mice is currentlyunknown.One way in which this could be determined would be to use a conditional Nfix allele,crossed to a cortex-spec
49、ific driver(e.g.,Emx1 Cre),thereby enabling the role of NFIX specifically inthe cerebral cortex to be separated from its role in other regions of the nervous system and body.An alternative approach would be a comprehensive analysis of adult Nfix heterozygous mice.Onestudy has shown that adult Nfix+/
50、mice exhibit deficits in hippocampal neurogenesis,andsubsequently in learning and memory 33,but no other potential cortical phenotypes wereanalyzed in this study.As such,whether these mice exhibit megalencephaly is unknown.Futurestudies of Nfix+/mice will have immediate relevance to one human disord